Expressing:Article Title: Cgas/sting sensing in dendritic cells discriminates between daptomycin sensitive and resistant staphylococcus aureus clinical isolates
Article Snippet: The sgRNA plasmid targeting murine Sting was introduced into Cas9 expressing 1049 MutuDC via third generation lentiviral transduction before antibiotic selection with puromycin 1050 (InvivoGen). .. Published here: 10.1182/blood-2007-06097576 n/a Mutu DC Line 2114 expressing Cas9 This paper n/a Mutu DC Line 2114 STING -/- This paper n/a Human embryonic kidney (HEK) 293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BL/6 mice Bred in house at Monash University Animal Research Platform Oligonucleotides sgRNA targeting sting (CAGTTGGATGTTTGGCCTTC) This paper n/a Recombinant DNA pALC2084: pALC2073 with gfp cloned into the EcoRI site Published here: doi.org/10.1073/pnas.18120 6611 pRSV-Rev Addgene Plasmid# 12253 pMDLg/pRRE Addgene Plasmid# 12251 pMD2.G Addgene Plasmid# 12259 pFgH1tUT-GFP Addgene Plasmid# 70183 Lenti‐Cas9‐2A‐Blast Addgene Plasmid#: 73310 pXPR_BRD003 Broad Institute, USA. https://portals.broadinstitu te.org/gpp/public/vector/d etails?vector=pXPR_003 Software and algorithms GraphPad Prism http://www.graphpad.com/ RRID:SCR_002798 Adobe Illustrator http://www.adobe.com/prod ucts/illustrator.html RRID:SCR_010279 Image Lab Bio-Rad Laboratories RRID:SCR_014210 Adobe Illustrator http://www.adobe.com/prod ucts/illustrator.html RRID:SCR_010279 Jo urn al Pr e-p r o f .. 1051 1052 Jo urn al Pr e-p roo f QUANTIFICATION AND STATISTICAL ANALYSIS 1053 GraphPad Prism was utilized to graph data and carry out statistical tests, where all test and p 1054 value details are located in Figure legends.
Recombinant:Article Title: Cgas/sting sensing in dendritic cells discriminates between daptomycin sensitive and resistant staphylococcus aureus clinical isolates
Article Snippet: The sgRNA plasmid targeting murine Sting was introduced into Cas9 expressing 1049 MutuDC via third generation lentiviral transduction before antibiotic selection with puromycin 1050 (InvivoGen). .. Published here: 10.1182/blood-2007-06097576 n/a Mutu DC Line 2114 expressing Cas9 This paper n/a Mutu DC Line 2114 STING -/- This paper n/a Human embryonic kidney (HEK) 293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BL/6 mice Bred in house at Monash University Animal Research Platform Oligonucleotides sgRNA targeting sting (CAGTTGGATGTTTGGCCTTC) This paper n/a Recombinant DNA pALC2084: pALC2073 with gfp cloned into the EcoRI site Published here: doi.org/10.1073/pnas.18120 6611 pRSV-Rev Addgene Plasmid# 12253 pMDLg/pRRE Addgene Plasmid# 12251 pMD2.G Addgene Plasmid# 12259 pFgH1tUT-GFP Addgene Plasmid# 70183 Lenti‐Cas9‐2A‐Blast Addgene Plasmid#: 73310 pXPR_BRD003 Broad Institute, USA. https://portals.broadinstitu te.org/gpp/public/vector/d etails?vector=pXPR_003 Software and algorithms GraphPad Prism http://www.graphpad.com/ RRID:SCR_002798 Adobe Illustrator http://www.adobe.com/prod ucts/illustrator.html RRID:SCR_010279 Image Lab Bio-Rad Laboratories RRID:SCR_014210 Adobe Illustrator http://www.adobe.com/prod ucts/illustrator.html RRID:SCR_010279 Jo urn al Pr e-p r o f .. 1051 1052 Jo urn al Pr e-p roo f QUANTIFICATION AND STATISTICAL ANALYSIS 1053 GraphPad Prism was utilized to graph data and carry out statistical tests, where all test and p 1054 value details are located in Figure legends.
Clone Assay:Article Title: Cgas/sting sensing in dendritic cells discriminates between daptomycin sensitive and resistant staphylococcus aureus clinical isolates
Article Snippet: The sgRNA plasmid targeting murine Sting was introduced into Cas9 expressing 1049 MutuDC via third generation lentiviral transduction before antibiotic selection with puromycin 1050 (InvivoGen). .. Published here: 10.1182/blood-2007-06097576 n/a Mutu DC Line 2114 expressing Cas9 This paper n/a Mutu DC Line 2114 STING -/- This paper n/a Human embryonic kidney (HEK) 293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BL/6 mice Bred in house at Monash University Animal Research Platform Oligonucleotides sgRNA targeting sting (CAGTTGGATGTTTGGCCTTC) This paper n/a Recombinant DNA pALC2084: pALC2073 with gfp cloned into the EcoRI site Published here: doi.org/10.1073/pnas.18120 6611 pRSV-Rev Addgene Plasmid# 12253 pMDLg/pRRE Addgene Plasmid# 12251 pMD2.G Addgene Plasmid# 12259 pFgH1tUT-GFP Addgene Plasmid# 70183 Lenti‐Cas9‐2A‐Blast Addgene Plasmid#: 73310 pXPR_BRD003 Broad Institute, USA. https://portals.broadinstitu te.org/gpp/public/vector/d etails?vector=pXPR_003 Software and algorithms GraphPad Prism http://www.graphpad.com/ RRID:SCR_002798 Adobe Illustrator http://www.adobe.com/prod ucts/illustrator.html RRID:SCR_010279 Image Lab Bio-Rad Laboratories RRID:SCR_014210 Adobe Illustrator http://www.adobe.com/prod ucts/illustrator.html RRID:SCR_010279 Jo urn al Pr e-p r o f .. 1051 1052 Jo urn al Pr e-p roo f QUANTIFICATION AND STATISTICAL ANALYSIS 1053 GraphPad Prism was utilized to graph data and carry out statistical tests, where all test and p 1054 value details are located in Figure legends.
Plasmid Preparation:Article Title: Cgas/sting sensing in dendritic cells discriminates between daptomycin sensitive and resistant staphylococcus aureus clinical isolates
Article Snippet: The sgRNA plasmid targeting murine Sting was introduced into Cas9 expressing 1049 MutuDC via third generation lentiviral transduction before antibiotic selection with puromycin 1050 (InvivoGen). .. Published here: 10.1182/blood-2007-06097576 n/a Mutu DC Line 2114 expressing Cas9 This paper n/a Mutu DC Line 2114 STING -/- This paper n/a Human embryonic kidney (HEK) 293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BL/6 mice Bred in house at Monash University Animal Research Platform Oligonucleotides sgRNA targeting sting (CAGTTGGATGTTTGGCCTTC) This paper n/a Recombinant DNA pALC2084: pALC2073 with gfp cloned into the EcoRI site Published here: doi.org/10.1073/pnas.18120 6611 pRSV-Rev Addgene Plasmid# 12253 pMDLg/pRRE Addgene Plasmid# 12251 pMD2.G Addgene Plasmid# 12259 pFgH1tUT-GFP Addgene Plasmid# 70183 Lenti‐Cas9‐2A‐Blast Addgene Plasmid#: 73310 pXPR_BRD003 Broad Institute, USA. https://portals.broadinstitu te.org/gpp/public/vector/d etails?vector=pXPR_003 Software and algorithms GraphPad Prism http://www.graphpad.com/ RRID:SCR_002798 Adobe Illustrator http://www.adobe.com/prod ucts/illustrator.html RRID:SCR_010279 Image Lab Bio-Rad Laboratories RRID:SCR_014210 Adobe Illustrator http://www.adobe.com/prod ucts/illustrator.html RRID:SCR_010279 Jo urn al Pr e-p r o f .. 1051 1052 Jo urn al Pr e-p roo f QUANTIFICATION AND STATISTICAL ANALYSIS 1053 GraphPad Prism was utilized to graph data and carry out statistical tests, where all test and p 1054 value details are located in Figure legends.
|
ATCC is a verified supplier 
ATCC manufactures this product 